Dmxl1^em1Dbrow
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dmxl1^em1Dbrow
• Name: Dmx-like 1; endonuclease-mediated mutation 1, Dennis Brown
• MGI ID: MGI:7790446
• Synonyms: Dmxl1^em1Debr, Dmxl1^fl
• Gene: Dmxl1 Location: Chr18:49965737-50098540 bp, + strand Genetic Position: Chr18, 27.12 cM
• Alliance: Dmxl1^em1Dbrow page

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Using CRISPR/cas9 endonuclease-mediated genome editing, guide RNAs (5'Guide GTAGTTGCTGACTTACAAGAAGG and 3' Guide CCAACTAGACCCAATTTGCATGG) were used to insert loxP sites flanking the exons 3-4 of the Dmx-like 1 (Dmxl1) gene on chromosome 18. (J:101977, J:359768)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dmxl1 Mutation: 156 strains or lines available

References

• Original: J:359768 Eaton AF, et al., Dmxl1 Is an Essential Mammalian Gene that Is Required for V-ATPase Assembly and Function In Vivo. Function (Oxf). 2024 Jul 11;5(4)
• All: 2 reference(s)