About   Help   FAQ
Leprem1Bshn
Endonuclease-mediated Allele Detail
Summary
Symbol: Leprem1Bshn
Name: leptin receptor; endonuclease-mediated mutation 1, Bo Shen
MGI ID: MGI:7788125
Gene: Lepr  Location: Chr4:101574601-101672549 bp, + strand  Genetic Position: Chr4, 46.96 cM
Alliance: Leprem1Bshn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Reporter)
Mutation:    Insertion
 
Mutation detailsUsing CRISPR technology, sgRNAs (TTATACATGACAGGCTCTACTGG) were designed to insert a 3 x monomeric blue fluorescent protein (mTagBFP2) sequence before the stop codon of the leptin receptor (Lepr) gene. (J:101977)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Lepr Mutation:  123 strains or lines available
References
Original:  J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory