About   Help   FAQ
Mmp1bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mmp1bem1(IMPC)J
Name: matrix metallopeptidase 1b (interstitial collagenase); endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7787086
Gene: Mmp1b  Location: Chr9:7368239-7388047 bp, - strand  Genetic Position: Chr9, 2.46 cM, cytoband A1-A2
Alliance: Mmp1bem1(IMPC)J page
IMPC: Mmp1b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GGGGTAGAGGGGACCTGTGA and TTAGAAAATACTGCAGTCCC. This resulted in a 1,598 bp deletion of Chr9:7,386,141-7,387,738 (GRCm38/mm10) that removes exon ENSMUSE00000302943, ENSMUSE00000983617 and ENSMUSE00000302891. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mmp1b Mutation:  32 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory