About   Help   FAQ
2300009A05Rikem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: 2300009A05Rikem1(IMPC)J
Name: RIKEN cDNA 2300009A05 gene; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7763954
Gene: 2300009A05Rik  Location: Chr9:63301729-63306526 bp, - strand  Genetic Position: Chr9, 34.06 cM, cytoband D
Alliance: 2300009A05Rikem1(IMPC)J page
IMPC: 2300009A05Rik gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: CAATGCACACTTTCAATACA and CTCCGCAGGGCCTCCATGGC. This resulted in a 4,723 bp deletion of Chr9:63,394,545-63,399,267(GRCm38/mm10) that removes exons ENSMUSE00000891268 and ENSMUSE00001014548. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any 2300009A05Rik Mutation:  8 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory