About   Help   FAQ
Gtf3c4em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gtf3c4em1(IMPC)J
Name: general transcription factor IIIC, polypeptide 4; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7714734
Gene: Gtf3c4  Location: Chr2:28712311-28730372 bp, - strand  Genetic Position: Chr2, 19.38 cM
Alliance: Gtf3c4em1(IMPC)J page
IMPC: Gtf3c4 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGGCTCAGTTTTGTGCAGCA and GTTAATACAGTTGCTATGGG. This resulted in a 4,963 bp deletion of Chr2:28,830,457-28,835,419 (GRCm38/mm10) that removes exons ENSMUSE00001238880 and ENSMUSE00000223849. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gtf3c4 Mutation:  23 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory