Del(5Rr481-Rr490)3Mam
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(5Rr481-Rr490)3Mam
• Name: deletion, chr 5, Lothar Hennighausen 3; deletion, Chr 5, Lothar Hennighausen 3
• MGI ID: MGI:7665220
• Synonyms: Csn2-deltaE1/E2/E3
• Gene: Del(5Rr481-Rr490)3Mam Location: unknown Genetic Position: Chr5, Syntenic

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Mutation details: The three Csn2 enhancers Rr481, Rr482 and Rr490 were deleted by targeting Rr481in zygotes that carry the Del(5Rr482-Rr490)2Mam allele (containing the deletion of the other two enhancers) using sgRNAs (equivalent to AGATGGTTCACAAACTCAACAGG and AGTGAACCCTAATGTAACAGTGG) with CRISPR/Cas9 technology, resulting in a 1381 bp deletion in addition to the existing 9271 bp Rr482+Rr490 deletion. (J:341588)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(5Rr481-Rr490)3Mam Mutation: 0 strains or lines available

References

• Original: J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
• All: 1 reference(s)