Del(5Rr482-Rr490)2Mam
Endonuclease-mediated Allele Detail

Summary

• Symbol: Del(5Rr482-Rr490)2Mam
• Name: deletion, chr 5, Lothar Hennighausen 2; deletion, Chr 5, Lothar Hennighausen 2
• MGI ID: MGI:7664575
• Synonyms: Csn2-deltaE2/3
• Gene: Del(5Rr482-Rr490)2Mam Location: unknown Genetic Position: Chr5, Syntenic

Mutation origin

• Strain of Origin: C57BL/6N

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intergenic deletion
• Del(5Rr482-Rr490)2Mam involves 2 genes/genome features (Rr482, Rr490) View all
• Mutation details: Two Csn2 enhancers, Rr482 and Rr490, were deleted using sgRNAs (equivalent to GCTGTTCTTAATTCAGGCCCAGG and GAACTGGCCCTTATCATTACTGG) with CRISPR/Cas9 technology, resulting in a 9271 bp deletion. (J:341588)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Del(5Rr482-Rr490)2Mam Mutation: 0 strains or lines available

References

• Original: J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
• All: 1 reference(s)