About   Help   FAQ
Del(5Rr482-Rr490)2Mam
Endonuclease-mediated Allele Detail
Summary
Symbol: Del(5Rr482-Rr490)2Mam
Name: deletion, chr 5, Lothar Hennighausen 2; deletion, Chr 5, Lothar Hennighausen 2
MGI ID: MGI:7664575
Synonyms: Csn2-deltaE2/3
Gene: Del(5Rr482-Rr490)2Mam  Location: unknown  Genetic Position: Chr5, Syntenic
Mutation
origin
Strain of Origin:  C57BL/6N
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
  Del(5Rr482-Rr490)2Mam involves 2 genes/genome features (Rr482, Rr490) View all
 
Mutation detailsTwo Csn2 enhancers, Rr482 and Rr490, were deleted using sgRNAs (equivalent to GCTGTTCTTAATTCAGGCCCAGG and GAACTGGCCCTTATCATTACTGG) with CRISPR/Cas9 technology, resulting in a 9271 bp deletion. (J:341588)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Del(5Rr482-Rr490)2Mam Mutation:  0 strains or lines available
References
Original:  J:341588 Lee HK, et al., Cell-specific and shared regulatory elements control a multigene locus active in mammary and salivary glands. Nat Commun. 2023 Aug 17;14(1):4992
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory