About   Help   FAQ
Rcsd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rcsd1em1(IMPC)J
Name: RCSD domain containing 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7624530
Gene: Rcsd1  Location: Chr1:165476503-165537632 bp, - strand  Genetic Position: Chr1, 72.99 cM
Alliance: Rcsd1em1(IMPC)J page
IMPC: Rcsd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: TGGTGATCTCTCCCGCAGCA and TTGAGCCTCTAGTCCGCACC. This resulted in a 687 bp. deletion of Chr1:165,655,350-165,656,036 (GRCm38/mm10) and removes exon ENSMUSE00000397738. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rcsd1 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory