Kcnt1em1Lekk
Endonuclease-mediated Allele Detail
|
Symbol: |
Kcnt1em1Lekk |
Name: |
potassium channel, subfamily T, member 1; endonuclease-mediated mutation 1, Leonard K Kaczmarek |
MGI ID: |
MGI:7624374 |
Synonyms: |
Kcnt1R455H, SlackR455H |
Gene: |
Kcnt1 Location: Chr2:25753807-25808285 bp, + strand Genetic Position: Chr2, 18.27 cM
|
Alliance: |
Kcnt1em1Lekk page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Arginine codon 455 (CGA) in exon 15 was changed to histidine (CAC) (p.R455H) using an sgRNA (equivalent to CCAGACCATCCTTCGAGCCTGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R474H mutation associated with epilepsy of infancy with migrating partial seizures of infancy (EIMFS) or malignant migrating partial seizures of infancy (MMPSI).
(J:287751)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Kcnt1 Mutation: |
66 strains or lines available
|
|
Original: |
J:287751 Quraishi IH, et al., Impaired motor skill learning and altered seizure susceptibility in mice with loss or gain of function of the Kcnt1 gene encoding Slack (KNa1.1) Na(+)-activated K(+) channels. Sci Rep. 2020 Feb 21;10(1):3213 |
All: |
2 reference(s) |
|