About   Help   FAQ
Kcnt1em1Lekk
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcnt1em1Lekk
Name: potassium channel, subfamily T, member 1; endonuclease-mediated mutation 1, Leonard K Kaczmarek
MGI ID: MGI:7624374
Synonyms: Kcnt1R455H, SlackR455H
Gene: Kcnt1  Location: Chr2:25753807-25808285 bp, + strand  Genetic Position: Chr2, 18.27 cM
Alliance: Kcnt1em1Lekk page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsArginine codon 455 (CGA) in exon 15 was changed to histidine (CAC) (p.R455H) using an sgRNA (equivalent to CCAGACCATCCTTCGAGCCTGGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.R474H mutation associated with epilepsy of infancy with migrating partial seizures of infancy (EIMFS) or malignant migrating partial seizures of infancy (MMPSI). (J:287751)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Kcnt1 Mutation:  70 strains or lines available
References
Original:  J:287751 Quraishi IH, et al., Impaired motor skill learning and altered seizure susceptibility in mice with loss or gain of function of the Kcnt1 gene encoding Slack (KNa1.1) Na(+)-activated K(+) channels. Sci Rep. 2020 Feb 21;10(1):3213
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory