Pogz^em1Tnkw
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pogz^em1Tnkw
• Name: pogo transposable element with ZNF domain; endonuclease-mediated mutation 1, Takanobu Nakazawa
• MGI ID: MGI:7615290
• Synonyms: POGZ^Q1038R
• Gene: Pogz Location: Chr3:94744878-94789637 bp, + strand Genetic Position: Chr3, 40.74 cM
• Alliance: Pogz^em1Tnkw page

Mutation origin

• Strain of Origin: C57BL/6NJcl

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Glutamine codon 1038 (CAG) in exon 19 was changed to arginine (CGG) (p.Q1038R) using an sgRNA (targeting GCAGCAGCTCCCTGTAAATG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the human p.Q1042R mutation associated with autism spectrum disorder (ASD). (J:286398)

Disease models

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pogz Mutation: 52 strains or lines available

References

• Original: J:286398 Matsumura K, et al., Pathogenic POGZ mutation causes impaired cortical development and reversible autism-like phenotypes. Nat Commun. 2020 Feb 26;11(1):859
• All: 1 reference(s)