Alpk1em1Dlka
Endonuclease-mediated Allele Detail
|
Symbol: |
Alpk1em1Dlka |
Name: |
alpha-kinase 1; endonuclease-mediated mutation 1, Daniel L Kastner |
MGI ID: |
MGI:7614851 |
Synonyms: |
Alpk1T237M |
Gene: |
Alpk1 Location: Chr3:127463959-127574176 bp, - strand Genetic Position: Chr3, 56.54 cM, cytoband H1
|
Alliance: |
Alpk1em1Dlka page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Threonine codon 237 (ACA) in exon 9 was changed to methionine (ATG) (p.T237M) using an sgRNA (targeting ACAGGGCATTTCCACATCAC) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the same human mutation associated with ROSAH (retinal dystrophy, optic nerve oedema, splenomegaly, anhidrosis and headache) syndrome.
(J:344848)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Alpk1 Mutation: |
76 strains or lines available
|
|
Original: |
J:344848 Kozycki CT, et al., Gain-of-function mutations in ALPK1 cause an NF-kappaB-mediated autoinflammatory disease: functional assessment, clinical phenotyping and disease course of patients with ROSAH syndrome. Ann Rheum Dis. 2022 Oct;81(10):1453-1464 |
All: |
1 reference(s) |
|