Klk11em1Zlin
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Klk11em1Zlin |
| Name: |
kallikrein related-peptidase 11; endonuclease-mediated mutation 1, Zhimiao Lin |
| MGI ID: |
MGI:7614790 |
| Synonyms: |
Klk11G44E |
| Gene: |
Klk11 Location: Chr7:43424041-43428687 bp, + strand Genetic Position: Chr7, 28.26 cM
|
| Alliance: |
Klk11em1Zlin page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Single point mutation
|
| |
|
Mutation details: Glycine codon 44 (GGA) in exon 3 was changed to glutamic acid (GAA) (c.131G>A:p.G44E) using an sgRNA (targeting GGAGAGACGAGGATCATCAA) and an ssODN template with CRISPR/Cas9 technology. The mutation, at the C-terminal edge of the signal peptide sequence of the encoded peptide, is the equivalent of the human c.149G>A (p.G50E) mutation associated with autosomal-dominant cornification disorder characterized by abnormal skin desquamation. The mutation interferes with signal peptide cleavage, leading to mislocalization of the protein.
(J:345142)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Klk11 Mutation: |
22 strains or lines available
|
|
| Original: |
J:345142 Gong Z, et al., Variants in KLK11, affecting signal peptide cleavage of kallikrein-related peptidase 11, cause an autosomal-dominant cornification disorder. Br J Dermatol. 2023 Jan 23;188(1):100-111 |
| All: |
1 reference(s) |
|