About   Help   FAQ
Tmem132cem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem132cem1(IMPC)J
Name: transmembrane protein 132C; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7608143
Gene: Tmem132c  Location: Chr5:127318890-127642854 bp, + strand  Genetic Position: Chr5, 65.4 cM
Alliance: Tmem132cem1(IMPC)J page
IMPC: Tmem132c gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences: GTCCACGACGACCAAAGCTA and GCGTAATTGCTACCTCCCAA. This resulted in a 1,099 bp. deletion of Chr5:127,359,435-127,360,533 (GRCm38/mm10) and removes exon ENSMUSE00000649462. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tmem132c Mutation:  41 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory