About   Help   FAQ
Matr3em1Lmjn
Endonuclease-mediated Allele Detail
Summary
Symbol: Matr3em1Lmjn
Name: matrin 3; endonuclease-mediated mutation 1, Lauryl Nutter
MGI ID: MGI:7606214
Gene: Matr3  Location: Chr18:35695191-35726888 bp, + strand  Genetic Position: Chr18, 19.14 cM, cytoband C
Alliance: Matr3em1Lmjn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, No functional change)
Mutation:    Insertion
 
Mutation detailsThis allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with a guide RNAs with the spacer sequences TGCTCTGATATCTAATATTG and GAACCACGAGAGTTGGTCAT. A single repair template containing the loxP sites, intervening sequence and flanking homology arms was delivered by incubating embryos with recombinant AAV. This resulting allele has loxP sites flanking exons ENSMUSE00000337447, ENSMUSE00000360581, and ENSMUSE00000341974 (GRCm39). Cre-mediated deletion of the loxP-flanked region is predicted to generate a null allele. (J:344138)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Matr3 Mutation:  113 strains or lines available
References
Original:  J:344138 The Centre for Phenogenomics, Strains and alleles submitted by The Centre for Phenogenomics. MGI Direct Data Submission. 2024;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory