About   Help   FAQ
Ido2em2Lamn
Endonuclease-mediated Allele Detail
Summary
Symbol: Ido2em2Lamn
Name: indoleamine 2,3-dioxygenase 2; endonuclease-mediated mutation 2, Laura Mandik-Nayak
MGI ID: MGI:7579076
Synonyms: IDO2 Y346X
Gene: Ido2  Location: Chr8:25021908-25066349 bp, - strand  Genetic Position: Chr8, 12.58 cM
Alliance: Ido2em2Lamn page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsTyrosine codon 346 (TAC) in exon 10 was changed to a stop codon (TAA) (p.Y346*) using sgRNAs (targeting ATCTGGCCACGACATTGATGTGG and CAGTTACCACATCAATGTCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of common human SNP rs4503083 (p.Y359*) that creates a KO allele. No protein expression was detected in the liver. (J:342726)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Ido2 Mutation:  40 strains or lines available
References
Original:  J:342726 Merlo LMF, et al., The Immunomodulatory Enzyme IDO2 Mediates Autoimmune Arthritis through a Nonenzymatic Mechanism. J Immunol. 2022 Feb 1;208(3):571-581
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory