Ido2^em1Lamn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ido2^em1Lamn
• Name: indoleamine 2,3-dioxygenase 2; endonuclease-mediated mutation 1, Laura Mandik-Nayak
• MGI ID: MGI:7579075
• Synonyms: IDO2 R235W
• Gene: Ido2 Location: Chr8:25021908-25066349 bp, - strand Genetic Position: Chr8, 12.58 cM
• Alliance: Ido2^em1Lamn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Arginine codon 235 (CGG) in exon 8 was changed to tryptophan (TGG) (p.R235W) using sgRNAs (targeting CTTACCCAGAGAGGAAGATC, GTCATCCGGATCTTCCTCTC, and TCATCCGGATCTTCCTCTCT) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of common human SNP rs10109853 (p.R248W) that renders the encoded peptide catalytically inactive. (J:342726)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ido2 Mutation: 41 strains or lines available

References

• Original: J:342726 Merlo LMF, et al., The Immunomodulatory Enzyme IDO2 Mediates Autoimmune Arthritis through a Nonenzymatic Mechanism. J Immunol. 2022 Feb 1;208(3):571-581
• All: 1 reference(s)