Sfxn2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Sfxn2em1(IMPC)J |
| Name: |
sideroflexin 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7568767 |
| Gene: |
Sfxn2 Location: Chr19:46561798-46585340 bp, + strand Genetic Position: Chr19, 38.96 cM, cytoband D1
|
| Alliance: |
Sfxn2em1(IMPC)J page
|
| IMPC: |
Sfxn2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCGAGATGGATGAACACGT and CCTCAAATATCAGGGTGGGA, which resulted in a 2681 bp deletion beginning at Chromosome 19 position 46,587,902 bp and ending after 46,590,582 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000147421,ENSMUSE00000147411, ENSMUSE00000147418, and ENSMUSE00000147415 (exons 5-8) and 2391 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 143 and early stop 50 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|