About   Help   FAQ
Gbp2bem1Mansm
Endonuclease-mediated Allele Detail
Summary
Symbol: Gbp2bem1Mansm
Name: guanylate binding protein 2b; endonuclease-mediated mutation 1, Si Ming Man
MGI ID: MGI:7567376
Synonyms: Gbp1-
Gene: Gbp2b  Location: Chr3:142300608-142324940 bp, + strand  Genetic Position: Chr3, 66.69 cM
Alliance: Gbp2bem1Mansm page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR/cas9 mediated recombination using a guide RNA (targeting AGACAACTCAGCTAACTTTGTGG in exon 5) resulted in a 2 bp deletion (c.504_505delCT), leading to a frameshift and premature stop codon (p.F169Cfs*21). (J:343418)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Gbp2b Mutation:  49 strains or lines available
References
Original:  J:343418 Feng S, et al., Pathogen-selective killing by guanylate-binding proteins as a molecular mechanism leading to inflammasome signaling. Nat Commun. 2022 Jul 29;13(1):4395
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/05/2026
MGI 6.24
The Jackson Laboratory