About   Help   FAQ
Lckem1Ewyh
Endonuclease-mediated Allele Detail
Summary
Symbol: Lckem1Ewyh
Name: lck proto-oncogene, Src family tyrosine kinase; endonuclease-mediated mutation 1, Elena W Y Hsieh
MGI ID: MGI:7565561
Synonyms: LckP440S
Gene: Lck  Location: Chr4:129442142-129467415 bp, - strand  Genetic Position: Chr4, 63.26 cM, cytoband distal
Alliance: Lckem1Ewyh page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Single point mutation
 
Mutation detailsProline codon 440 (CCT) in exon 11 was changed to serine (TCT) (p.P440S) using an sgRNA (targeting CTGGGTAAGGGATTCGACCGTGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is equivalent to the same human mutation associated with combined immunodeficiencies (CID). (J:342630)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Lck Mutation:  96 strains or lines available
References
Original:  J:342630 Lui VG, et al., A partial human LCK defect causes a T cell immunodeficiency with intestinal inflammation. J Exp Med. 2024 Jan 1;221(1)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory