Galt^em1Bmrn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Galt^em1Bmrn
• Name: galactose-1-phosphate uridyl transferase; endonuclease-mediated mutation 1, BioMarin Pharmaceutical
• MGI ID: MGI:7564216
• Synonyms: Galt^DelEx2-7
• Gene: Galt Location: Chr4:41755228-41758695 bp, + strand Genetic Position: Chr4, 22.07 cM
• Alliance: Galt^em1Bmrn page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intergenic deletion
• Mutation details: CRISPR/cas9 endonuclease-mediated genome editing is used to delete exons 2-7 using sgRNA (CCCCTCCGCCAGCCTATAGCTTC,TAGGGCATTAGAGCCACTCGGG and ATATTATGGTGGCTTAGGGTAGG, CCCTCTCACATGCACGATTCACT). The 1537 bp [bps 41755833 to 41757369, using GRCm39 (NC_000070.7)] deletion includes exons 2-7, and parts of introns 1 and 7 including the nucleotides coding for the enzyme's His-Pro-His active site. (J:101977)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Galt Mutation: 16 strains or lines available

References

• Original: J:101977 The Jackson Laboratory, Information obtained from The Jackson Laboratory, Bar Harbor, ME. Unpublished. 2005-2017
• All: 1 reference(s)