Ntrk1^em1Krvl
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ntrk1^em1Krvl
• Name: neurotrophic tyrosine kinase, receptor, type 1; endonuclease-mediated mutation 1, Rejji Kuruvilla
• MGI ID: MGI:7544953
• Synonyms: TrkA^R685A
• Gene: Ntrk1 Location: Chr3:87685551-87702469 bp, - strand Genetic Position: Chr3, 38.62 cM
• Alliance: Ntrk1^em1Krvl page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codon 685 (CGA) in exon 15 was changed to alanine (GCC) (p.R685A) using a crRNA (targeting AAGGTTTAGGGACACTTACTCGG) and an ssODN template with CRIPSR/Cas9 technology. The mutation abolishes PTP1B binding and, consequently, NTRK1 dephosphorylation. (J:338830)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Ntrk1 Mutation: 60 strains or lines available

References

• Original: J:338830 Connor B, et al., Transcytosis-mediated anterograde transport of TrkA receptors is necessary for sympathetic neuron development and function. Proc Natl Acad Sci U S A. 2023 Feb 7;120(6):e2205426120
• All: 1 reference(s)