About   Help   FAQ
Bcl7aem1Jlp
Endonuclease-mediated Allele Detail
Summary
Symbol: Bcl7aem1Jlp
Name: B cell CLL/lymphoma 7A; endonuclease-mediated mutation 1, Jose de la Pompa
MGI ID: MGI:7543637
Synonyms: Bcl7aAG,GA
Gene: Bcl7a  Location: Chr5:123482511-123512146 bp, + strand  Genetic Position: Chr5, 62.92 cM, cytoband F
Alliance: Bcl7aem1Jlp page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsTwo mutations were introduced in intron 2 using a crNA (targeting TGGGGGCTCTGACTGTTTGA) and an ssODN template with CRISPR/Cas9 technology: c.175-106A>G and c.175-76G>A. These mutations are the equivalent of human SNPs rs884785 (c.175-56A>G) and rs884786 (c.175-27G>A) found in some left ventricular noncompaction (LVNC) patients. (J:338889)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Bcl7a Mutation:  29 strains or lines available
References
Original:  J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory