Tmx3em1Jlp
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Tmx3em1Jlp |
| Name: |
thioredoxin-related transmembrane protein 3; endonuclease-mediated mutation 1, Jose de la Pompa |
| MGI ID: |
MGI:7543636 |
| Synonyms: |
Tmx3F191X |
| Gene: |
Tmx3 Location: Chr18:90528336-90561391 bp, + strand Genetic Position: Chr18, 59.37 cM
|
| Alliance: |
Tmx3em1Jlp page
|
|
|
|
| Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: Two nucleotides (TT) were deleted from intron 8 (c.579+8_579+9delTT) using a crRNA (targeting CTCAGAAGATGTGGTTCCTG) and an ssODN template with CRISPR/Cas9 technology. This sequence could represent the last two nucleotides of phenylalanine codon 196 (TTT) in an unannotated alternatively spliced transcript, equivalent to codon F193 (TTT) in the human TMX3-204 (ENST00000562706.5) transcript. Another human alternatively spliced transcript TMX3-202 (ENST00000443099.6) has a TT deletion in codon F191 (in its alternative 3' end in what is intron 9 sequence for transcript TMX3-201) (SNP rs143627864), which leads to a frameshift and resulting stop codon (TAA) in place of the phenylalanine codon (F191fs*), in some left ventricular noncompaction (LVNC) patients. The allele was created in zygotes that contained the Mib1em2Jlp allele and created at the same time as the Cep192em1Jlp allele.
(J:338889)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Tmx3 Mutation: |
26 strains or lines available
|
|
| Original: |
J:338889 Siguero-Alvarez M, et al., A Human Hereditary Cardiomyopathy Shares a Genetic Substrate With Bicuspid Aortic Valve. Circulation. 2023 Jan 3;147(1):47-65 |
| All: |
1 reference(s) |
|