Wwox^em1Mald
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wwox^em1Mald
• Name: WW domain-containing oxidoreductase; endonuclease-mediated mutation 1, Marcelo Aldaz
• MGI ID: MGI:7541100
• Synonyms: Wwox^P47T
• Gene: Wwox Location: Chr8:115166395-116079447 bp, + strand Genetic Position: Chr8, 60.99 cM, cytoband E1
• Alliance: Wwox^em1Mald page

Mutation origin

• Strain of Origin: FVB/N

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Nucleotide substitutions
• Mutation details: Proline codon 47 (CCG) in exon 2 was changed to threonine (ACC) (NM_019573.3:c.139_141delCCGinsACC, NP_062519.2:p.P47T) using an sgRNA (targeting CAGTGGGAACATCCGAAAACCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, located in the first WW domain of the encoded peptide, represents the same human mutation associated with autosomal recessive cerebellar ataxia with epilepsy and intellectual disability (SCAR12, MIM:614322). (J:339564)

Disease models

Expression

In Mice Carrying this Mutation:	1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation:	8 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Wwox Mutation: 59 strains or lines available

References

• Original: J:339564 Hussain T, et al., WWOX P47T partial loss-of-function mutation induces epilepsy, progressive neuroinflammation, and cerebellar degeneration in mice phenocopying human SCAR12. Prog Neurobiol. 2023 Apr;223:102425
• All: 1 reference(s)