About   Help   FAQ
Wwoxem1Mald
Endonuclease-mediated Allele Detail
Summary
Symbol: Wwoxem1Mald
Name: WW domain-containing oxidoreductase; endonuclease-mediated mutation 1, Marcelo Aldaz
MGI ID: MGI:7541100
Synonyms: WwoxP47T
Gene: Wwox  Location: Chr8:115166395-116079447 bp, + strand  Genetic Position: Chr8, 60.99 cM, cytoband E1
Alliance: Wwoxem1Mald page
Mutation
origin
Strain of Origin:  FVB/N
Mutation
description
Allele Type:    Endonuclease-mediated (Humanized sequence)
Mutation:    Nucleotide substitutions
 
Mutation detailsProline codon 47 (CCG) in exon 2 was changed to threonine (ACC) (NM_019573.3:c.139_141delCCGinsACC, NP_062519.2:p.P47T) using an sgRNA (targeting CAGTGGGAACATCCGAAAACCGG) and an ssODN template with CRISPR/Cas9 technology. The mutation, located in the first WW domain of the encoded peptide, represents the same human mutation associated with autosomal recessive cerebellar ataxia with epilepsy and intellectual disability (SCAR12, MIM:614322). (J:339564)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Disease models
Loading...
Expression
In Mice Carrying this Mutation: 1 RNA-Seq or microarray experiment(s)
In Structures Affected by this Mutation: 8 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Wwox Mutation:  58 strains or lines available
References
Original:  J:339564 Hussain T, et al., WWOX P47T partial loss-of-function mutation induces epilepsy, progressive neuroinflammation, and cerebellar degeneration in mice phenocopying human SCAR12. Prog Neurobiol. 2023 Apr;223:102425
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory