Epcam^em3Rosza
Endonuclease-mediated Allele Detail

Summary

• Symbol: Epcam^em3Rosza
• Name: epithelial cell adhesion molecule; endonuclease-mediated mutation 3, Roman Szabo
• MGI ID: MGI:7539350
• Synonyms: Epcam^AA
• Gene: Epcam Location: Chr17:87943407-87958555 bp, + strand Genetic Position: Chr17, 57.87 cM
• Alliance: Epcam^em3Rosza page

Mutation origin

• Strain of Origin: FVB/NJ

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: Arginine codons 80 (AGG) and 81 (AGG) in exon 4 were changed to alanine (GCC, GCA) (p.R80_R81delinsAA) using sgRNAs (targeting GAGGAGGATAAAGCCCGAAG and TGACTCACAGCAAGTCTGGG) and an ssODN template with CRISPR/Cas9 technology. R80 is essential for matriptase-mediated cleavage of the encoded peptide. (J:340720)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Epcam Mutation: 31 strains or lines available

References

• Original: J:340720 Szabo R, et al., Early-onset tufting enteropathy in HAI-2-deficient mice is independent of matriptase-mediated cleavage of EpCAM. Development. 2023 Sep 1;150(17)
• All: 1 reference(s)