Poglut2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Poglut2^em1(IMPC)J
• Name: protein O-glucosyltransferase 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7537141
• Gene: Poglut2 Location: Chr1:44145706-44157968 bp, - strand Genetic Position: Chr1, 23.54 cM, cytoband C1
• Alliance: Poglut2^em1(IMPC)J page
• IMPC: Poglut2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATGATAGCAATGTCAATCT and CTATGCAAAGAGGGCCAGAT, which resulted in a 648 bp deletion beginning at Chromosome 1 position 44,114,398 bp and ending after 44,115,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261539 and ENSMUSE00001261784 (exons 3 and 4) and 364 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 130 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Poglut2 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)