Poglut2em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Poglut2em1(IMPC)J |
| Name: |
protein O-glucosyltransferase 2; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7537141 |
| Gene: |
Poglut2 Location: Chr1:44145706-44157968 bp, - strand Genetic Position: Chr1, 23.54 cM, cytoband C1
|
| Alliance: |
Poglut2em1(IMPC)J page
|
| IMPC: |
Poglut2 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TATGATAGCAATGTCAATCT and CTATGCAAAGAGGGCCAGAT, which resulted in a 648 bp deletion beginning at Chromosome 1 position 44,114,398 bp and ending after 44,115,045 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261539 and ENSMUSE00001261784 (exons 3 and 4) and 364 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 130 and early truncation 9 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|