Pik3r2^em1Gldn
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pik3r2^em1Gldn
• Name: phosphoinositide-3-kinase regulatory subunit 2; endonuclease-mediated mutation 1, Jeffrey A Golden
• MGI ID: MGI:7529483
• Synonyms: Pik3r2^KI
• Gene: Pik3r2 Location: Chr8:71220820-71229357 bp, - strand Genetic Position: Chr8, 34.15 cM
• Alliance: Pik3r2^em1Gldn page

Mutation origin

• Strain of Origin: C57BL/6

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutation: Single point mutation
• Mutation details: Glycine codon 367 (GGG) in exon 10 was changed to arginine (AGG) (c.1099G>A, p.G367R) using an sgRNA (targeting TAATACGACTCACTATAGGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human c.1117G>A (p.G373R) mutation associated with megalencephaly polymicrogyria polydactyly hydrocephalus (MPPH) syndrome. (J:304006)

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pik3r2 Mutation: 38 strains or lines available

References

• Original: J:304006 Shi X, et al., PIK3R2/Pik3r2 Activating Mutations Result in Brain Overgrowth and EEG Changes. Ann Neurol. 2020 Dec;88(6):1077-1094
• All: 1 reference(s)