About   Help   FAQ
Tyrem1Gfng
Endonuclease-mediated Allele Detail
Summary
Symbol: Tyrem1Gfng
Name: tyrosinase; endonuclease-mediated mutation 1, Guoping Feng
MGI ID: MGI:7526756
Synonyms: TyrC89S, Tyrem1Guof
Gene: Tyr  Location: Chr7:87073979-87142637 bp, - strand  Genetic Position: Chr7, 49.01 cM
Alliance: Tyrem1Gfng page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsCysteine codon 89 (TGC) was changed to serine (AGC) (p.C89S) using an sgRNA (targeting CCTGCCAGTGCTCAGGCAACTTC) and an ssODN template with CRISPR/Cas9 technology. This mutation is associated with albinism. (J:334099)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tyr Mutation:  382 strains or lines available
References
Original:  J:334099 Wilde JJ, et al., Efficient embryonic homozygous gene conversion via RAD51-enhanced interhomolog repair. Cell. 2021 Jun 10;184(12):3267-3280.e18
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory