Polr1aem3Knwea
Endonuclease-mediated Allele Detail
|
Symbol: |
Polr1aem3Knwea |
Name: |
polymerase (RNA) I polypeptide A; endonuclease-mediated mutation 3, Kathryn Nicole Weaver |
MGI ID: |
MGI:7526145 |
Synonyms: |
Polr1aA1632V_P1635L |
Gene: |
Polr1a Location: Chr6:71886037-71956419 bp, + strand Genetic Position: Chr6, 32.21 cM
|
Alliance: |
Polr1aem3Knwea page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Humanized sequence) |
Mutation: |
|
Nucleotide substitutions
|
|
|
Mutation details: Proline codon 1635 (CCT) in exon 33 was changed to leucine (CTT) (c.4904C>T, p.P1635L) using an sgRNA (targeting GCCACCAGGGAGAGATGGCGAGG) and an ssODN template with CRISPR/Cas9 technology. The mutation is the equivalent of the rare human POLR1A c.4913C>T (p.Pro1638Leu) mutation associated with craniofacial, neural, and cardiac anomalies. This allele also contains an unintended c.4895C>T (p.A1632V) mutation in cis.
(J:335489)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Polr1a Mutation: |
93 strains or lines available
|
|
Original: |
J:335489 Smallwood K, et al., POLR1A variants underlie phenotypic heterogeneity in craniofacial, neural, and cardiac anomalies. Am J Hum Genet. 2023 May 4;110(5):809-825 |
All: |
1 reference(s) |
|