About   Help   FAQ
Dpysl2em1Jpka
Endonuclease-mediated Allele Detail
Summary
Symbol: Dpysl2em1Jpka
Name: dihydropyrimidinase-like 2; endonuclease-mediated mutation 1, Josef P Kapfhammer
MGI ID: MGI:7526125
Synonyms: CRMP2ki, CRMP2-T555A
Gene: Dpysl2  Location: Chr14:67040313-67148410 bp, - strand  Genetic Position: Chr14, 34.6 cM
Alliance: Dpysl2em1Jpka page
Mutation
origin
Strain of Origin:  FVB
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Single point mutation
 
Mutation detailsThreonine codon 555 (ACC) in exon 14 was changed to alanine (GCC) (c.1663A>G, p.T555A) using a crRNA (targeting GGGTGCCACGATGCGCTGGGTGG) and an ssODN tempate with CRISPR/Cas9 technology. The mutation replaces a phosphorylatable residue in the encoded peptide with a phosphoblocker. (J:336786)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Dpysl2 Mutation:  36 strains or lines available
References
Original:  J:336786 Winkler SC, et al., PKCgamma-Mediated Phosphorylation of CRMP2 Regulates Dendritic Outgrowth in Cerebellar Purkinje Cells. Mol Neurobiol. 2020 Dec;57(12):5150-5166
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory