Tnfrsf9^em1Kmm
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tnfrsf9^em1Kmm
• Name: tumor necrosis factor receptor superfamily, member 9; endonuclease-mediated mutation 1, Kenneth M Murphy
• MGI ID: MGI:7521992
• Gene: Tnfrsf9 Location: Chr4:151004612-151030561 bp, + strand Genetic Position: Chr4, 81.52 cM
• Alliance: Tnfrsf9^em1Kmm page

Mutation origin

• Strain of Origin: B6.129P2(FVB)-Cd27^tm1Jbo/J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Guide RNAs (tgcatgtgacatttcgccatggg and gttatcacaggagttctgcacgg) are used to delete exon 2, including the translation initiation site. (J:333733)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Tnfrsf9 Mutation: 37 strains or lines available

References

• Original: J:333733 Wu R, et al., Mechanisms of CD40-dependent cDC1 licensing beyond costimulation. Nat Immunol. 2022 Nov;23(11):1536-1550
• All: 1 reference(s)