About   Help   FAQ
Tmem161bem3Jgg
Endonuclease-mediated Allele Detail
Summary
Symbol: Tmem161bem3Jgg
Name: transmembrane protein 161B; endonuclease-mediated mutation 3, Joseph G Gleeson
MGI ID: MGI:7520092
Synonyms: Tmem161b LOF
Gene: Tmem161b  Location: Chr13:84370415-84444085 bp, + strand  Genetic Position: Chr13, 44.2 cM
Alliance: Tmem161bem3Jgg page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Not Specified
 
Mutation detailsLeucine codon 85 and tryptophan codon 317 were targeted for changing to arginine using sgRNAs (targeting CAGACTTGGTTTCTAGATGA and CATTTGATACTCTTCGACTC) and ssODN templates with CRISPR/Cas9 technology. This allele knockout allele, with an unspecified frameshifting genome sequence mutation, results from incorrect repair of the targeted sequence. (J:338312)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 6 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tmem161b Mutation:  52 strains or lines available
References
Original:  J:338312 Wang L, et al., TMEM161B modulates radial glial scaffolding in neocortical development. Proc Natl Acad Sci U S A. 2023 Jan 24;120(4):e2209983120
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory