About   Help   FAQ
Mplkipem2Nimo
Endonuclease-mediated Allele Detail
Summary
Symbol: Mplkipem2Nimo
Name: M-phase specific PLK1 intereacting protein; endonuclease-mediated mutation 2, Nima Mosammaparast
MGI ID: MGI:7518887
Synonyms: Ttdn1delta, Ttdn1delta34
Gene: Mplkip  Location: Chr13:17869998-17873697 bp, + strand  Genetic Position: Chr13, 6.05 cM, cytoband A3.1
Alliance: Mplkipem2Nimo page
Mutation
origin
Strain of Origin:  C57BL/6
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsMethionine codon 143 in exon 2 was targeted for change to valine using an sgRNA (targeting TTCAATGCTTGAAGACCCTTNGG) and an ssODN template with CRISPR/Cas9 technology. Besides the intended allele (Mplkipem1Nimo), this also created this allele that has a 34 bp deletion (TGAAGACCCTTGGGCTGGCCTAGAACCAGTGTCT), which leads to a frameshift and premature stop codon. No protein is expressed from this allele. (J:338438)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 2 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mplkip Mutation:  14 strains or lines available
References
Original:  J:338438 Townley BA, et al., A functional link between lariat debranching enzyme and the intron-binding complex is defective in non-photosensitive trichothiodystrophy. Mol Cell. 2023 Jul 6;83(13):2258-2275.e11
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory