Mplkipem2Nimo
Endonuclease-mediated Allele Detail
|
Symbol: |
Mplkipem2Nimo |
Name: |
M-phase specific PLK1 intereacting protein; endonuclease-mediated mutation 2, Nima Mosammaparast |
MGI ID: |
MGI:7518887 |
Synonyms: |
Ttdn1delta, Ttdn1delta34 |
Gene: |
Mplkip Location: Chr13:17869998-17873697 bp, + strand Genetic Position: Chr13, 6.05 cM, cytoband A3.1
|
Alliance: |
Mplkipem2Nimo page
|
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: Methionine codon 143 in exon 2 was targeted for change to valine using an sgRNA (targeting TTCAATGCTTGAAGACCCTTNGG) and an ssODN template with CRISPR/Cas9 technology. Besides the intended allele (Mplkipem1Nimo), this also created this allele that has a 34 bp deletion (TGAAGACCCTTGGGCTGGCCTAGAACCAGTGTCT), which leads to a frameshift and premature stop codon. No protein is expressed from this allele.
(J:338438)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
Carrying any Mplkip Mutation: |
14 strains or lines available
|
|
Original: |
J:338438 Townley BA, et al., A functional link between lariat debranching enzyme and the intron-binding complex is defective in non-photosensitive trichothiodystrophy. Mol Cell. 2023 Jul 6;83(13):2258-2275.e11 |
All: |
1 reference(s) |
|