Rorc^{em1(Thy1)Aben}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rorc^{em1(Thy1)Aben}
• Name: RAR-related orphan receptor gamma; endonuclease-mediated mutation 1, Albert Bendelac
• MGI ID: MGI:7518202
• Synonyms: Rorc^Thy1.1
• Gene: Rorc Location: Chr3:94280101-94305583 bp, + strand Genetic Position: Chr3, 40.56 cM, cytoband F2
• Alliance: Rorc^{em1(Thy1)Aben} page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Inserted expressed sequence)
• Mutation: Insertion
• Rorc^{em1(Thy1)Aben} expresses 1 gene
  Knock-in expresses:
  

  Organism	Expressed Gene	Note
  mouse	Thy1 (MGI:98747)	a variant

• Mutation details: CRISPR/cas9 genome editing used a guide crRNA [GTCCTACAAGGCAAGCCTAG] to insert an internal ribosomal entry site (IRES)/thymus cell antigen 1, theta (Thy1.1) a variant sequence into the 3' UTR of the gene. Rorc transcript Rorc-201 (ENSMUST00000029795.10) was used as reference for the exon number and guide sequences. (J:307783)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rorc Mutation: 42 strains or lines available

References

• Original: J:307783 Kasal DN, et al., Multi-transcription factor reporter mice delineate early precursors to the ILC and LTi lineages. J Exp Med. 2021 Feb 1;218(2)
• All: 1 reference(s)