About   Help   FAQ
Rorcem1(Thy1)Aben
Endonuclease-mediated Allele Detail
Summary
Symbol: Rorcem1(Thy1)Aben
Name: RAR-related orphan receptor gamma; endonuclease-mediated mutation 1, Albert Bendelac
MGI ID: MGI:7518202
Synonyms: RorcThy1.1
Gene: Rorc  Location: Chr3:94280106-94305583 bp, + strand  Genetic Position: Chr3, 40.56 cM, cytoband F2
Alliance: Rorcem1(Thy1)Aben page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Inserted expressed sequence)
Mutation:    Insertion
 
Rorcem1(Thy1)Aben expresses 1 gene
 
Mutation detailsCRISPR/cas9 genome editing used a guide crRNA [GTCCTACAAGGCAAGCCTAG] to insert an internal ribosomal entry site (IRES)/thymus cell antigen 1, theta (Thy1.1) a variant sequence into the 3' UTR of the gene. Rorc transcript Rorc-201 (ENSMUST00000029795.10) was used as reference for the exon number and guide sequences. (J:307783)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Rorc Mutation:  42 strains or lines available
References
Original:  J:307783 Kasal DN, et al., Multi-transcription factor reporter mice delineate early precursors to the ILC and LTi lineages. J Exp Med. 2021 Feb 1;218(2)
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory