About   Help   FAQ
Mettl16em3Embrp
Endonuclease-mediated Allele Detail
Summary
Symbol: Mettl16em3Embrp
Name: methyltransferase 16, N6-methyladenosine; endonuclease-mediated mutation 3, Ramesh S Pillai
MGI ID: MGI:7514380
Synonyms: Mettl16em3Rspi, Mettl16 F187G
Gene: Mettl16  Location: Chr11:74661658-74716649 bp, + strand  Genetic Position: Chr11, 45.76 cM, cytoband B4
Alliance: Mettl16em3Embrp page
Mutation
origin
Strain of Origin:  (C57BL/6J x DBA/2J)F1/J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsPhenylalanine codon 187 (TTT) in exon 5 was changed to glycine (GGC) (p.F187G) using an sgRNA (targeting ACTCCTGATGGATGCGCTTA) and an ssODN template with CRISPR/Cas9 technology. This mutation renders the encoded peptide catalytic-dead, losing its RNA methylation activity. (J:314427)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Mettl16 Mutation:  70 strains or lines available
References
Original:  J:314427 Mendel M, et al., Splice site m(6)A methylation prevents binding of U2AF35 to inhibit RNA splicing. Cell. 2021 Jun 10;184(12):3125-3142.e25
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory