Zfp276em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zfp276em1(IMPC)J |
| Name: |
zinc finger protein (C2H2 type) 276; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7513907 |
| Gene: |
Zfp276 Location: Chr8:123980934-123996484 bp, + strand Genetic Position: Chr8, 72.09 cM
|
| Alliance: |
Zfp276em1(IMPC)J page
|
| IMPC: |
Zfp276 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGCAAATGTGACATAAGCG and GATGGTTTACAGGTTAGCAG, which resulted in a 2961 bp deletion beginning at Chromosome 8 position 123,255,684 bp and ending after 123,258,644 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001238666, ENSMUSE00001307651, ENSMUSE00001236036, ENSMUSE00000215264 and ENSMUSE00001232446 (exons 2-6) and 2000 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 70 and early truncation 60 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|