Zfp276^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp276^em1(IMPC)J
• Name: zinc finger protein (C2H2 type) 276; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7513907
• Gene: Zfp276 Location: Chr8:123980934-123996484 bp, + strand Genetic Position: Chr8, 72.09 cM
• Alliance: Zfp276^em1(IMPC)J page
• IMPC: Zfp276 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGCAAATGTGACATAAGCG and GATGGTTTACAGGTTAGCAG, which resulted in a 2961 bp deletion beginning at Chromosome 8 position 123,255,684 bp and ending after 123,258,644 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001238666, ENSMUSE00001307651, ENSMUSE00001236036, ENSMUSE00000215264 and ENSMUSE00001232446 (exons 2-6) and 2000 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 70 and early truncation 60 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp276 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)