Tgm2^em1Lsan
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tgm2^em1Lsan
• Name: transglutaminase 2, C polypeptide; endonuclease-mediated mutation 1, Lakshmi Santhanam
• MGI ID: MGI:7506246
• Synonyms: Tgm2-C277S
• Gene: Tgm2 Location: Chr2:157958325-157988312 bp, - strand Genetic Position: Chr2, 78.72 cM
• Alliance: Tgm2^em1Lsan page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Nucleotide substitutions
• Mutation details: CRISPR/cas9 endonuclease-mediated genome editing uses two guide RNAs [GTGCTGGGTGTTTGCAGCGGTGG and AGTGAAGTACGGGCAGTGCTGGG] to insert the cysteine to serine amino acid substitution in at residue 277 (exon 6). Tgm2 transcript Tgm2-201 was used as reference for the exon numbers and guide sequence (ENSMUSG00000037820). (J:337709)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Tgm2 Mutation: 51 strains or lines available

References

• Original: J:337709 Wang H, et al., Probing tissue transglutaminase mediated vascular smooth muscle cell aging using a novel transamidation-deficient Tgm2-C277S mouse model. Cell Death Discov. 2021 Jul 29;7(1):197
• All: 1 reference(s)