About   Help   FAQ
Tgm2em1Lsan
Endonuclease-mediated Allele Detail
Summary
Symbol: Tgm2em1Lsan
Name: transglutaminase 2, C polypeptide; endonuclease-mediated mutation 1, Lakshmi Santhanam
MGI ID: MGI:7506246
Synonyms: Tgm2-C277S
Gene: Tgm2  Location: Chr2:157958325-157988312 bp, - strand  Genetic Position: Chr2, 78.72 cM
Alliance: Tgm2em1Lsan page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Nucleotide substitutions
 
Mutation detailsCRISPR/cas9 endonuclease-mediated genome editing uses two guide RNAs [GTGCTGGGTGTTTGCAGCGGTGG and AGTGAAGTACGGGCAGTGCTGGG] to insert the cysteine to serine amino acid substitution in at residue 277 (exon 6). Tgm2 transcript Tgm2-201 was used as reference for the exon numbers and guide sequence (ENSMUSG00000037820). (J:337709)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Tgm2 Mutation:  51 strains or lines available
References
Original:  J:337709 Wang H, et al., Probing tissue transglutaminase mediated vascular smooth muscle cell aging using a novel transamidation-deficient Tgm2-C277S mouse model. Cell Death Discov. 2021 Jul 29;7(1):197
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory