Pabir1^em2Yhua
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pabir1^em2Yhua
• Name: PP2A A alpha (PPP2R1A) and B55A (PPP2R2A) interacting phosphatase regulator 1; endonuclease-mediated mutation 2, Ying Huang
• MGI ID: MGI:7494165
• Synonyms: Fam122a^-
• Gene: Pabir1 Location: Chr19:24453866-24454720 bp, - strand Genetic Position: Chr19, 19.53 cM, cytoband C1
• Alliance: Pabir1^em2Yhua page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: A 29-bp deletion (TCGGCCTCGCCGGTCCGAATGCACAGC) causing a frameshift was generated via CRISPR/Cas9 technology. Western blot analysis confirmed absence of protein. (J:337007)

Expression

In Mice Carrying this Mutation:

4 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Pabir1 Mutation: 5 strains or lines available

References

• Original: J:337007 Yang YS, et al., FAM122A Is Required for Mesendodermal and Cardiac Differentiation of Embryonic Stem Cells. Stem Cells. 2023 Apr 25;41(4):354-367
• All: 1 reference(s)