Phldb3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Phldb3^em1(IMPC)J
• Name: pleckstrin homology like domain, family B, member 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:7481968
• Gene: Phldb3 Location: Chr7:24310188-24328722 bp, + strand Genetic Position: Chr7, 11.8 cM
• Alliance: Phldb3^em1(IMPC)J page
• IMPC: Phldb3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATCTGATGACATCACTTGG and GCTCAGTTCTGGCTTCGGAT, which resulted in a 3288 bp deletion beginning at Chromosome 7 position 24,623,679 bp and ending after 24,626,966 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000890035, ENSMUSE00000890716, ENSMUSE00000499900, ENSMUSE00000891408, ENSMUSE00000479582 (exons 10-14) and 2714 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 384 and early truncation 34 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Phldb3 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)