Rr417^em1Abfi
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rr417^em1Abfi
• Name: regulatory region 417; endonuclease-mediated mutation 1, Anthony B Firulli
• MGI ID: MGI:7461786
• Synonyms: Klf2^{delta-50:(3.9kb)}
• Gene: Rr417 Location: Chr8:73020823-73023378 bp Genetic Position: Chr8, Syntenic
• Alliance: Rr417^em1Abfi page

Mutation origin

• Strain of Origin: Not Specified

Mutation description

• Allele Type: Endonuclease-mediated (Modified regulatory region)
• Mutation: Intragenic deletion
• Mutation details: CRISPR-targeting, using two sgRNAs (targeting CTACTACTTGGCAGGTTGGAGGG and GTCAAAGGGACCTGGTAGTTTGG), removed the endothelial/endocardial enhancer located -50kb upstream of the Klf2 gene transcription initiation site (chr8:72266979-72269534; mm10). This allele contains a 4.3 kb deletion/400 bp insertion encompassing all of the 2556 bp size enhancer. (J:333400)

Expression

In Mice Carrying this Mutation:

5 assay results

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Rr417 Mutation: 0 strains or lines available

References

• Original: J:333400 George RM, et al., Single cell evaluation of endocardial Hand2 gene regulatory networks reveals HAND2-dependent pathways that impact cardiac morphogenesis. Development. 2023 Feb 15;150(3):dev201341
• All: 1 reference(s)