Rr417em1Abfi
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Rr417em1Abfi |
| Name: |
regulatory region 417; endonuclease-mediated mutation 1, Anthony B Firulli |
| MGI ID: |
MGI:7461786 |
| Synonyms: |
Klf2delta-50:(3.9kb) |
| Gene: |
Rr417 Location: Chr8:73020823-73023378 bp Genetic Position: Chr8, Syntenic
|
| Alliance: |
Rr417em1Abfi page
|
|
| Strain of Origin: |
Not Specified
|
|
| Allele Type: |
|
Endonuclease-mediated (Modified regulatory region) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: CRISPR-targeting, using two sgRNAs (targeting CTACTACTTGGCAGGTTGGAGGG and GTCAAAGGGACCTGGTAGTTTGG), removed the endothelial/endocardial enhancer located -50kb upstream of the Klf2 gene transcription initiation site (chr8:72266979-72269534; mm10). This allele contains a 4.3 kb deletion/400 bp insertion encompassing all of the 2556 bp size enhancer.
(J:333400)
|
|
|
|
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Rr417 Mutation: |
0 strains or lines available
|
|
| Original: |
J:333400 George RM, et al., Single cell evaluation of endocardial Hand2 gene regulatory networks reveals HAND2-dependent pathways that impact cardiac morphogenesis. Development. 2023 Feb 15;150(3):dev201341 |
| All: |
1 reference(s) |
|