About   Help   FAQ
Rr417em1Abfi
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr417em1Abfi
Name: regulatory region 417; endonuclease-mediated mutation 1, Anthony B Firulli
MGI ID: MGI:7461786
Synonyms: Klf2delta-50:(3.9kb)
Gene: Rr417  Location: Chr8:73020823-73023378 bp  Genetic Position: Chr8, Syntenic
Alliance: Rr417em1Abfi page
Mutation
origin
Strain of Origin:  Not Specified
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intragenic deletion
 
Mutation detailsCRISPR-targeting, using two sgRNAs (targeting CTACTACTTGGCAGGTTGGAGGG and GTCAAAGGGACCTGGTAGTTTGG), removed the endothelial/endocardial enhancer located -50kb upstream of the Klf2 gene transcription initiation site (chr8:72266979-72269534; mm10). This allele contains a 4.3 kb deletion/400 bp insertion encompassing all of the 2556 bp size enhancer. (J:333400)
Expression
In Mice Carrying this Mutation: 5 assay results
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr417 Mutation:  0 strains or lines available
References
Original:  J:333400 George RM, et al., Single cell evaluation of endocardial Hand2 gene regulatory networks reveals HAND2-dependent pathways that impact cardiac morphogenesis. Development. 2023 Feb 15;150(3):dev201341
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory