Nrxn1^em1Joez
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nrxn1^em1Joez
• Name: neurexin I; endonuclease-mediated mutation 1, Zhaolan Zhou
• MGI ID: MGI:7449236
• Synonyms: Nrxn1^{deltaIntron17}
• Gene: Nrxn1 Location: Chr17:90341059-91400499 bp, - strand Genetic Position: Chr17, 59.73 cM
• Alliance: Nrxn1^em1Joez page

Mutation origin

• Strain of Origin: C57BL/6J x SJL

Mutation description

• Allele Type: Endonuclease-mediated (Not Applicable)
• Mutation: Intragenic deletion
• Mutation details: CRISPR/Cas9 technology using sgRNAs 5 AATATGTGGGCAAGCTGGGTTGG 3 AND 5GAAATGGTACCTTTGATTAAGG 3 generated an approximate 20 kb deletion at intron 17. This is similar to a deletion identified in an individual on the autism spectrum. Both Nrxn1alpha and Nrxn1gamma transcript levels are unaffected while Nrxn1beta levels are slightly reduced in homozygous males but not in females. (J:334083)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Nrxn1 Mutation: 102 strains or lines available

References

• Original: J:334083 Xu B, et al., Allelic contribution of Nrxn1alpha to autism-relevant behavioral phenotypes in mice. PLoS Genet. 2023 Feb;19(2):e1010659
• All: 1 reference(s)