Grin2b^em1Weya
Endonuclease-mediated Allele Detail

Summary

• Symbol: Grin2b^em1Weya
• Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2); endonuclease-mediated mutation 1, Wei Yang
• MGI ID: MGI:7449028
• Synonyms: GluN2B-Y1070F KI
• Gene: Grin2b Location: Chr6:135690231-136150509 bp, - strand Genetic Position: Chr6, 66.38 cM
• Alliance: Grin2b^em1Weya page

Mutation origin

• Strain of Origin: Not Applicable

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Nucleotide substitutions
• Mutation details: Tyrosine codon 1070 (TAT) was changed to phenylalanine (TTC) (p.Y1070F) through an AT>TC mutation in exon 14 or 15 (depending on splice variant) using an sgRNA (targeting TCCACGCATACTGTCACCTA) and ssODN template (ATCTCCACGCATACTGTCACCTTCGGCAAC) with CRISPR/Cas9 technology. This mutation prevents phosphorylation of the residue. (J:334279)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Grin2b Mutation: 100 strains or lines available

References

• Original: J:334279 Shi X, et al., Disrupting phosphorylation of Tyr-1070 at GluN2B selectively produces resilience to depression-like behaviors. Cell Rep. 2021 Aug 24;36(8):109612
• All: 1 reference(s)