About   Help   FAQ
Grin2bem1Weya
Endonuclease-mediated Allele Detail
Summary
Symbol: Grin2bem1Weya
Name: glutamate receptor, ionotropic, NMDA2B (epsilon 2); endonuclease-mediated mutation 1, Wei Yang
MGI ID: MGI:7449028
Synonyms: GluN2B-Y1070F KI
Gene: Grin2b  Location: Chr6:135690231-136150509 bp, - strand  Genetic Position: Chr6, 66.38 cM
Alliance: Grin2bem1Weya page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Not Specified)
Mutation:    Nucleotide substitutions
 
Mutation detailsTyrosine codon 1070 (TAT) was changed to phenylalanine (TTC) (p.Y1070F) through an AT>TC mutation in exon 14 or 15 (depending on splice variant) using an sgRNA (targeting TCCACGCATACTGTCACCTA) and ssODN template (ATCTCCACGCATACTGTCACCTTCGGCAAC) with CRISPR/Cas9 technology. This mutation prevents phosphorylation of the residue. (J:334279)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Grin2b Mutation:  101 strains or lines available
References
Original:  J:334279 Shi X, et al., Disrupting phosphorylation of Tyr-1070 at GluN2B selectively produces resilience to depression-like behaviors. Cell Rep. 2021 Aug 24;36(8):109612
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory