Grin2bem1Weya
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Grin2bem1Weya |
| Name: |
glutamate receptor, ionotropic, NMDA2B (epsilon 2); endonuclease-mediated mutation 1, Wei Yang |
| MGI ID: |
MGI:7449028 |
| Synonyms: |
GluN2B-Y1070F KI |
| Gene: |
Grin2b Location: Chr6:135690231-136150509 bp, - strand Genetic Position: Chr6, 66.38 cM
|
| Alliance: |
Grin2bem1Weya page
|
|
| Strain of Origin: |
Not Applicable
|
|
| Allele Type: |
|
Endonuclease-mediated (Not Specified) |
| Mutation: |
|
Nucleotide substitutions
|
| |
|
Mutation details: Tyrosine codon 1070 (TAT) was changed to phenylalanine (TTC) (p.Y1070F) through an AT>TC mutation in exon 14 or 15 (depending on splice variant) using an sgRNA (targeting TCCACGCATACTGTCACCTA) and ssODN template (ATCTCCACGCATACTGTCACCTTCGGCAAC) with CRISPR/Cas9 technology. This mutation prevents phosphorylation of the residue.
(J:334279)
|
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
| Mouse strains and cell lines
available from the International Mouse Strain Resource
(IMSR) |
| Carrying this Mutation: |
Mouse Strains: 0 strains available
Cell Lines: 0 lines available
|
| Carrying any Grin2b Mutation: |
101 strains or lines available
|
|
| Original: |
J:334279 Shi X, et al., Disrupting phosphorylation of Tyr-1070 at GluN2B selectively produces resilience to depression-like behaviors. Cell Rep. 2021 Aug 24;36(8):109612 |
| All: |
1 reference(s) |
|