About   Help   FAQ
Nesem1Pqt
Endonuclease-mediated Allele Detail
Summary
Symbol: Nesem1Pqt
Name: nestin; endonuclease-mediated mutation 1, Paul Q Thomas
MGI ID: MGI:7447464
Synonyms: Nes FS
Gene: Nes  Location: Chr3:87878400-87887758 bp, + strand  Genetic Position: Chr3, 38.78 cM
Alliance: Nesem1Pqt page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details

Exons 1 and 4 were targeted with two sgRNAs (targeting GGAGCTCAATCGACGCCTGG and GCACAGGAGACCCTACTAAA) using CRISPR/Cas9 technology, resulting in an 8 bp deletion in exon 1 (CGCCTGGA chr3:87878561-87878568 (GRCm39)) that creates a reading frame shift and premature stop codon. (J:314040)

Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Nes Mutation:  85 strains or lines available
References
Original:  J:314040 Thomson E, et al., The Nestin neural enhancer is essential for normal levels of endogenous Nestin in neuroprogenitors but is not required for embryo development. PLoS One. 2021;16(11):e0258538
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/14/2026
MGI 6.24
The Jackson Laboratory