Msl3^em1Forni
Endonuclease-mediated Allele Detail

Summary

• Symbol: Msl3^em1Forni
• Name: MSL complex subunit 3; endonuclease-mediated mutation 1, Paolo Forni
• MGI ID: MGI:7447459
• Synonyms: Msl3^flox
• Gene: Msl3 Location: ChrX:167437113-167456894 bp, - strand Genetic Position: ChrX, 78.73 cM
• Alliance: Msl3^em1Forni page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready)
• Mutation: Insertion
• Mutation details: Guide RNAs (CAGGGCTGTTCTCTCTAGTCTGG and GTCCCTGTGATCAGTCGGCATGG) are designed to insert loxP sites flanking exons 2-4. (J:341578)

Expression

In Mice Carrying this Mutation:

1 RNA-Seq or microarray experiment(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Msl3 Mutation: 12 strains or lines available

References

• Original: J:341578 Mitchell TA, et al., Loss of function of male-specific lethal 3 (Msl3) does not affect spermatogenesis in rodents. Dev Dyn. 2023 Oct 17
• All: 1 reference(s)