Nxpe4em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Nxpe4em1(IMPC)J |
| Name: |
neurexophilin and PC-esterase domain family, member 4; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7447104 |
| Gene: |
Nxpe4 Location: Chr9:48073321-48311325 bp, + strand Genetic Position: Chr9, 26.39 cM
|
| Alliance: |
Nxpe4em1(IMPC)J page
|
| IMPC: |
Nxpe4 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTCTTGGTCCATAGTAGGCA and GTGACCAAGTCCAACAGAAA, which resulted in a 464 bp deletion beginning at Chromosome 9 position 48,393,961 bp and ending after 48,394,424 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000334056 (exon 7) and 402 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 275 and early truncation 19 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
1 reference(s) |
|