Igk^em1Vic
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igk^em1Vic
• Name: immunoglobulin kappa chain complex; endonuclease-mediated mutation 1, Gabriel D Victora
• MGI ID: MGI:7442151
• Synonyms: Igk^Tag
• Gene: Igk Location: Chr6:67532620-70703738 bp, + strand Genetic Position: Chr6, 30.89 cM, cytoband F1-pter

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Conditional ready, Epitope tag)
• Mutation: Insertion
• Mutation details: Guide RNA (GGAGCTGGTGGTGGCGTCTC) is designed to introduce a loxP-flanked FLAG-tag (DYKDDDDK), followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag (WSHPQFEK) into the C-terminus of the gene. (J:333805)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Igk Mutation: 27 strains or lines available

References

• Original: J:333805 Schiepers A, et al., Molecular fate-mapping of serum antibody responses to repeat immunization. Nature. 2023 Jan 16
• All: 2 reference(s)