About   Help   FAQ
Igkem1Vic
Endonuclease-mediated Allele Detail
Summary
Symbol: Igkem1Vic
Name: immunoglobulin kappa chain complex; endonuclease-mediated mutation 1, Gabriel D Victora
MGI ID: MGI:7442151
Synonyms: IgkTag
Gene: Igk  Location: Chr6:67532620-70703738 bp, + strand  Genetic Position: Chr6, 30.89 cM, cytoband F1-pter
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Conditional ready, Epitope tag)
Mutation:    Insertion
 
Mutation detailsGuide RNA (GGAGCTGGTGGTGGCGTCTC) is designed to introduce a loxP-flanked FLAG-tag (DYKDDDDK), followed by stop codons and an SV40 polyadenylation sequence, and Strep-II tag (WSHPQFEK) into the C-terminus of the gene. (J:333805)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Igk Mutation:  33 strains or lines available
References
Original:  J:333805 Schiepers A, et al., Molecular fate-mapping of serum antibody responses to repeat immunization. Nature. 2023 Jan 16;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory