About   Help   FAQ
Rr388em1Zyliu
Endonuclease-mediated Allele Detail
Summary
Symbol: Rr388em1Zyliu
Name: regulatory region 388; endonuclease-mediated mutation 1, Zhiyong Liu
MGI ID: MGI:7440077
Synonyms: E3 KO, Eh2-
Gene: Rr388  Location: Chr6:64774536-64777054 bp  Genetic Position: Chr6, Syntenic
Alliance: Rr388em1Zyliu page
Mutation
origin
Strain of Origin:  Not Applicable
Mutation
description
Allele Type:    Endonuclease-mediated (Modified regulatory region)
Mutation:    Intergenic deletion
 
Mutation detailsAtoh1 enhancer Eh2 or E3 was targeted with sgRNAs (targeting AGAGGGATCAAAGTATCTAT and GTGCATAGCACTTCCATAGT) using CRISPR/Cas9 technology, resulting in a 3033 bp deletion (chr6:64774177-64777209 (GRCm39)) including the enhancer. This allele was created in cells that already carry the Rr387em1Zyliu Atoh1 enhancer Eh1 or E0 deletion allele. (J:332270, J:333396)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Rr388 Mutation:  0 strains or lines available
References
Original:  J:333396 Luo Z, et al., Three distinct Atoh1 enhancers cooperate for sound receptor hair cell development. Proc Natl Acad Sci U S A. 2022 Aug 9;119(32):e2119850119
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory