About   Help   FAQ
Endonuclease-mediated Allele Detail
Symbol: Lrrc28em1(IMPC)J
Name: leucine rich repeat containing 28; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:7439819
Gene: Lrrc28  Location: Chr7:67163158-67295016 bp, - strand  Genetic Position: Chr7, 37.05 cM, cytoband C
Alliance: Lrrc28em1(IMPC)J page
IMPC: Lrrc28 gene page
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGTGAGAAGAGTGATGAG and CAAACAGAGCTTGTATTAGC, which resulted in a 1450 bp deletion beginning at Chromosome 7 position 67,617,757 bp and ending after 67,619,206 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200384, ENSMUSE00000200380 (exons 4 and 5) and 1274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 70 and early truncation 13 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Lrrc28 Mutation:  20 strains or lines available
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
MGI 6.23
The Jackson Laboratory