Ccdc93em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ccdc93em1(IMPC)J |
| Name: |
coiled-coil domain containing 93; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:7427746 |
| Synonyms: |
Ccdc93- |
| Gene: |
Ccdc93 Location: Chr1:121358796-121434189 bp, + strand Genetic Position: Chr1, 52.97 cM, cytoband E2
|
| Alliance: |
Ccdc93em1(IMPC)J page
|
| IMPC: |
Ccdc93 gene page |
|
Ccdc93em1(IMPC)J/Ccdc93em1(IMPC)J mice exhibit embryonic lethality between E7.5 and E9.5, growth retardation, poorly organized extraembryonic tissues, failure of primitive streak formation and gastrulation, and increased cell death.
Show the 1 phenotype image(s) involving this allele.
|
|
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACATGCATGTAAGGTCACAA and AAGAATCCCTGTCAGCTGCG, which resulted in a 328 bp deletion beginning at Chromosome 1 position 121,441,594 bp and ending after 121,441,921 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001261988 (exon 4) and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 84 and early truncation 2 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|