Slc25a5^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Slc25a5^{em1(IMPC)Hmgu}
• Name: solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 5; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:7425979
• Gene: Slc25a5 Location: ChrX:36059304-36062460 bp, + strand Genetic Position: ChrX, 21.2 cM, cytoband A4
• Alliance: Slc25a5^{em1(IMPC)Hmgu} page
• IMPC: Slc25a5 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Helmholtz-Zentrum Muenchen using Cas9 and guides with spacer sequences AAGGTCATAGGTACGCTTGA, ACAACGCGGTGTGGGCTCGC, AGTTATAGGAACTCAACCTA, and ATGGCTATGAATGGGTAGCC that targeted exon(s) ENSMUSE00000556251.2 ENSMUSE00002027292.1 ENSMUSE00002027293.1 ENSMUSE00002125838.1 ENSMUSE00002161782.1. This resulted in deletion(s) of 796 bp (location: ChrX:36060255-36061050; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Slc25a5 Mutation: 8 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)